Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E309813

Search information 
Request: 309813Match: SGN-E309813
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98578Clone name: cLEZ-10-K23
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309813Length: 454 bp (987 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E309813 [] (trimmed) GCACGTGGCACCATTCAGTGATGAATATTTGTATCTGGAAATTGCAAATAAGGCTATTTTTTGGCAGCAACAGAGCTATTTTGGGGTTGATTTAA
CACCCTTGCAAAGATCTGCATATGAAGGATACTTTTCTCAGCCAGTGGTTGATGCTTTTGATCCAAGGTTATTGGTAGCTCCTGCAATATCTCAT
GCGATTAACTTCACTTTAATAAAGGAAGAAGATCTATATGAAATTGAGATCCCATTGAAATTTGCATGTTCTGTTAGCACTAGAATTCATGGGCT
GGCTTGCTGGTTTGATGTACTATTCAATGGAAGCACTGTACCGAGGTGGCTTACCACTGCTCCTGGTGCACCTACAACTCACTGGTATCAGCTTC
CGTGTGTATTGTCACAGCCCCTTTATGTCATGCCAGGACAAGAGATAACTGGCAACTTTCGCCTGGTTGCCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309813] SGN-U567451 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122483 [Download] [View] Facility Assigned ID: TRZBK72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0104 Quality Trim Threshold: 14.5