EST details — SGN-E309909

Search information 
Request: 309909Match: SGN-E309909
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98540Clone name: cLEZ-10-G8
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: Alias clone SGN-C185234 is on microarray TOM1: SGN-S1-1-1.2.12.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185234 [TUS-46-N16] Trace: SGN-T192038 EST: SGN-E390712 Direction: 5' Facility: INRA
Clone: SGN-C185234 [TUS-46-N16] Trace: SGN-T192282 EST: SGN-E390956 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309909Length: 361 bp (980 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E309909 [] (trimmed) GGTTTCATCCCCACCTCCTGTTGTAACTTCTCCACCACCAGCACCTCCTACTCCTATTGCTTCTCCTCCTCCACCAGTGAACTCTCCACCTCCTC
CAGCAGCACCTTCTCCTGCGCCACTTGCATCAACTCCTGCTCCAGCTCCTGCGAAGAAATTGACTTCTCCAGCACCATCTCCTTTAGGATTTAGT
CCTGCCGCCCCAGCCCTAGCCCCAAGTCTTGGAGCTTTATCTCCTGCTCCTTCAGCTACTGATCAGAGCGGAGTAGAGGGCCTGAAATTGTCAAC
AATGATCGTGAAAAGCTTGGTCTTAGGATGGGGTCTACTCAGCTTTCTAATGTAGAACTCTCTTTCATCCTGCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309909] SGN-U572871 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122579 [Download] [View] Facility Assigned ID: TRZBL40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0460 Quality Trim Threshold: 12.5