EST details — SGN-E310092

Search information 
Request: 310092Match: SGN-E310092
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100400Clone name: cLEZ-8-B18
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: Alias clone SGN-C183432 is on microarray TOM1: SGN-S1-1-3.3.1.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183432 [TUS-42-C14] Trace: SGN-T196008 EST: SGN-E394682 Direction: 5' Facility: INRA
Clone: SGN-C183432 [TUS-42-C14] Trace: SGN-T199671 EST: SGN-E398345 Direction: 3' Facility: INRA
Clone: SGN-C183432 [TUS-42-C14] Trace: SGN-T200453 EST: SGN-E399570 Direction: 5' Facility: INRA
Clone: SGN-C183432 [TUS-42-C14] Trace: SGN-T200277 EST: SGN-E399229 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E310092Length: 620 bp (821 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E310092 [] (trimmed) GGCTGTATTGGAGTGCCACATGGCCCAAAGAAGTTGAGCAGCTTGCAAGACAATTCCTTTTCAATGCATACAAAGTAATTATTGGTTCAGCTGAC
CTGAAAGCTAATCACGCTATTCGTCAGCATGTGGAAATCGTCTCGGAGAGCCAGAAGTATAATAAATTAGTAAAGTTGCTGGAAGATATTATGGA
TGGTAGTCGGATTTTAATATTCATGGACACTAAAAAGGGGTGTGACCAAGTAACTCGGCAGCTCCGGATGGATGGTTGGCCGGCACTTTCTATTC
ATGGTGATAAGAGTCAAGCAGAAAGAGATTGGGTCCTTTCAGAATTCAAAGCTGGAAAGTCTCCTATAATGACAGCTACAGACGTTGCTGCTCGA
GGTCTAGATGTGAAGGATGTAAAGTTTGTAATCAACTATGATTTTCCTGGATCATTGGAGGACTATGTTCACCGAATTGGTAGAACGGGAAGAGC
TGGTGCCTCAGGGACAGCATACACATTCTTTACTGCAGCGAATGCTAGGTTTGCGAAGGACCTTGTTAACATTCTTGAGGAGGCTGGACAGAAAG
TCAGTCCTGAATTGGCAAAAATGGGACGTGGTGCTCCTCCCCCTCCTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E310092] SGN-U584535 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122058 [Download] [View] Facility Assigned ID: TRZBF09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5