Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E310647

Search information 
Request: 310647Match: SGN-E310647
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99752Clone name: cLEZ-19-B20
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193591 [TUS-68-J21] Trace: SGN-T346529 EST: SGN-E545654 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193591 [TUS-68-J21] Trace: SGN-T346530 EST: SGN-E545655 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E310647Length: 577 bp (859 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E310647 [] (trimmed) GCTCATGGATGTATATGCTAAGTGTGGAAAGGTGGAAAATACAGTAGACATGTTTCTGGAGACTGAAAACATAAATGATGTGTCATGGAACACTA
TTATTGTTGGCCATGTACAATGTGGAGATGGAGAGAAGGCACTAGCTCTGTTTATTGATATGCATGAAGCTCAAGGGCGAGCTTCATCGGTGACA
TATTCGTCTCTGCTGCGTGCTTGTGCAACCCTGGCTGCATTGGAGCCAGGTCTTCAAATTCACTCGTTTACTATAAAAACCATTTACGATCAAGA
TCTTGCAGTTGGAAATGCTTTAGTGGATATGTATGCAAAATGTGGGAGTATTAAGGATGCTCGGTTGGTGTTTGAAATGATGATTGAGCGAGATG
TTGTATCATGGAATGCTATGGTTTCAGCATATTCCATGCATGGTCTTGGGAATGAAGCTCTCAGTATCTTTGAGAGAATGCGCAGAACGCATGTC
AAACCTAATCAATTAACATTTCTTGGTGTCCTTTCAGCATGTAGCAATTCAGGATCTTTGAATCATGGATATGCCTATCCCTCTTTGATGCTGGA
TGATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E310647] SGN-U584856 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123848 [Download] [View] Facility Assigned ID: TRZCX10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5