EST details — SGN-E310919

Search information 
Request: 310919Match: SGN-E310919
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99388Clone name: cLEZ-17-F21
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193526 [TUS-68-H4] Trace: SGN-T346418 EST: SGN-E545543 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C193526 [TUS-68-H4] Trace: SGN-T350099 EST: SGN-E549224 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E310919Length: 579 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E310919 [] (trimmed) GCCTCTTTGTACCAAATTTTGTAAAACTTTCTAAAGCTGAATTTAGCAATGGATTATGATCCATCGGATGAGAAAAAGGCTATTGATGATACAAA
AGCTGGTGTTAAGGGACTAGTTGATTCTGGAATAGTCAAGATTCCAAGAATTTTCATTAGGCCACCTCATGAACTTGCTGAGGAGTTGAATATGT
GCAAGTCAACTCTACAGGTTCCGGTGGTGGATCTAAGTGGCATTGAAGTTGAAGATCGGCGTAAGATCATTGTTGATGAAATAAGGGAAGTATCT
GAGACACTGGGACTTTTCCAAGTGATAAATCATGGGATTCCTTCAAGAGTTTTGGAAGGAATGATTGATGGGACTCGTAAATTTCATGAACAAGA
TGTCGAAGTGAAGAAAGAGTACTATTCGTCTGATCCAACAACCAGACGAGTTAGATATGATGGCAATGTTCATGTGTACAAAACAGAAGGAAAGA
CTGCACACTGGAAGGATACATTGTATGTCGCTGGGCTAGTTTCTGGTCACATTGAACCTGAAGAATTACCAGAAGTTTGCAGGAAGGAATACGTT
GAGTACACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E310919] SGN-U579343 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123344 [Download] [View] Facility Assigned ID: TRZCO35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5