EST details — SGN-E310933

Search information 
Request: 310933Match: SGN-E310933
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99493Clone name: cLEZ-17-N15
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E310933Length: 576 bp (840 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E310933 [] (trimmed) TTTTAATGCAGTTCTTGGTGGTGATAGATTAGAAAAGATTGATAAAGAGAGAGCAGGTGTTCTTGTAGGAACAGGAATGGGTGGTCTTACAGTTT
TCTCAGATGGTGTACAAAACCTAATTGAAAAGGGTCACAGGAAAATTACTCCATTTTTTGTACCATATGCCATAACAAACATGGGTTCTGCTTTG
CTTGGTATTGATCTTGGTTTTATGGGACCAAACTACTCAATCTCAACTGCTTGTGCTACCTCCAATTACTGTTTTTATGCTGCCGCTAATCACAT
CCGTAGAGGTGAAGCGGATTTGATGCTTGCTGGTGGAACTGAAGCTGCCATAATACCTATTGGTTTAGGAGGTTTTGTGGCATGCAGAGCTTTGT
CTCAAAGAAATGATGATCCACAAACTGCTTCCAGGCCGTGGGACAAAGAAAGAGATGGATTTGTTATGGGAGAGGGGGCTGGAATCTTGGTGATG
GAAAGTTTGGAGCATGCAATGAAACGAGGAGCGCCAATAATTGCAGAGTATTTGGGTGGTGCAGTTAATTGTGATGCTTATCACATGACCGATCC
CCGAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E310933] SGN-U578896 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123358 [Download] [View] Facility Assigned ID: TRZCO80THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5