EST details — SGN-E311029

Search information 
Request: 311029Match: SGN-E311029
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99416Clone name: cLEZ-17-H3
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193531 [TUS-68-H9] Trace: SGN-T346426 EST: SGN-E545551 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193531 [TUS-68-H9] Trace: SGN-T346427 EST: SGN-E545552 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311029Length: 551 bp (847 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311029 [] (trimmed) TGTAGAAGGCTTTCTCAGTTCTTAAGAGCTCTCTGTTTTCTCCTTCCTTCGTGTATACACACACCATTTTGTGTTTTTGTTTTTGAAACAATGAC
GGTCCAAAAGGCATTCGTTGCAATGCTTATTGCATCCTTTCTACTAGTCCATTTCGCTAATGCTCAAAAGGTTGACTACAGCAAGCCACCAGCAT
CAGCCCCTCAAGGTCCACAGCCACTAGATTGCATAGGAGCTTGTAAATATCGGTGCAGTGAGTCGTCCAGGCAAAATCTATGCAACAGAGCATGT
GGAAGCTGCTGCCATAGATGCCACTGTGTGCCACCAGGGACTTCTGGAAATTATGAATCATGCCCTTGCTATTTCAATCTTACGACTCATAACAC
CACCCGCAAATGCCCTTAATCCCTTTTTCTTAGTTTTTAAATTTGTTCCCCAAAGGAAGTCCATTTTCAAAAAAAAAAACAGAGTGTAACTTTCA
ATTCAATTCAATGTTCCTTCTGTTTACGAAGCTTGTGATGATGCAATAATACATAAGTATTTATAACTTTGTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311029] SGN-U581603 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123454 [Download] [View] Facility Assigned ID: TRZCO38THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0023 Quality Trim Threshold: 12.5