EST details — SGN-E311042

Search information 
Request: 311042Match: SGN-E311042
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99465Clone name: cLEZ-17-L11
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193539 [TUS-68-H17] Trace: SGN-T346440 EST: SGN-E545565 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311042Length: 287 bp (886 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311042 [] (trimmed) CCCAAAAAAACCAGGTTCACGAGGCGAAAATTGATTTTTTTAACACCAGGATGAAAAAGTTAAAATTGGGAACAGAAAAAAAGGTAGCTACCTGT
TCTTGAAACGTCTCGTTGATTTCATTTGTGGTTATAGCATCACCGATTTTTCAATCTTCAAAAAGTTGACTGTTTGGTGTAAAAGCGGGGGCCAA
CAGCCCCTCCCAAAATATTCAAAGGACCCAAAAACGGGGGGATCTTAAGGATGAACTTTGTTGTTTTGCCCGGGTTGAAATGAGGCTGCTTTGGA
GG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311042] SGN-U588833 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123467 [Download] [View] Facility Assigned ID: TRZCO66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.895 Expected Error Rate: 0.0323 Quality Trim Threshold: 14.5