EST details — SGN-E311203

Search information 
Request: 311203Match: SGN-E311203
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99188Clone name: cLEZ-16-G20
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: Alias clone SGN-C184857 is on microarray TOM1: SGN-S1-1-2.2.14.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184857 [TUS-45-N23] Trace: SGN-T198747 EST: SGN-E397421 Direction: 3' Facility: INRA
Clone: SGN-C184857 [TUS-45-N23] Trace: SGN-T200052 EST: SGN-E398726 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311203Length: 594 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311203 [] (trimmed) GCTGATTCGGAAATTTTTTCTCTATCTGGGTTCCTTTTTCTACCGTCAAATACTCAATTGAACTAATTAGAAAACCATATATTCGGTTTATGTCT
CTTTCTATTCACTACCTCTTCATCATTTTCTAGCTTATTCTCTTTCTCTCTCTACAACTTTTTCTTCTTCTTCTGGGTTTTGATTCTGACTGCAA
GATGAAGAAATTTATCTTGAATTTGGAGGTGCATGATGTAAGAGACAAGCGCAAGGCCTTGAAGACGGTCTCTGCTCTTCCAGGAATTGATGAAA
TCTCAATGGATATGAAAGGTAAGAAATTAACCATCATCGGAACAGTTGATCCAGTGAGTGTAGTGAGCAAACTTCGGAAATTTTGGCCAGCACAC
ATAATCTCAGTAGGACCAGCGAAAGAGCCAGAGAAGAAAGAGGAACCAAAGAAAGAAGAGGCCAAGAAAGAGGAGGCTAAGAAGGAGGGCGAGGG
CAAGAAAGAAGACGCTCCGAAGGAGGAAGGTAAGAAAGAGGAGGGTAAGAAGGAAGAAGAAGGTAAGAAGGATGAAAATAAGAAAGACGAGCCCA
AAAAGGACGGAGAGAAGAAAGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311203] SGN-U586322 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123205 [Download] [View] Facility Assigned ID: TRZCJ46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5