EST details — SGN-E311327

Search information 
Request: 311327Match: SGN-E311327
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99667Clone name: cLEZ-18-M1
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311327Length: 374 bp (863 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E311327 [] (trimmed) GTTCACCACCAGCACCTACTCCTACCGGTGGTGCACCGGCGGATCAGCCTTCTGCCGACAACACACCGTCGTCGCCTAACGCCGGTAACAGAGCC
GTCATTGGCGGTGCTGCGTTCGCTGGCGTGATCATCGCTGCTGCTTTGATGTAGAGGTGACACGTGTACTAACACGTGTCTTGTTCTTTTGATGG
ACGGACGAGATTTGTTTTTTCTAATACTTTAAATTACTTTTTGTAATTTTGTGATTTATTTGTTTTTGGTACATTGTGGGTTTTTTATTTTTATT
TTTATTTTGTTAATTATATTTTTCATTTTAGAGTGAATCATTCATCATCCTTGTGTACATTTTAAGTGAAATAAATTTGAGTTTTTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311327] SGN-U576576 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123542 [Download] [View] Facility Assigned ID: TRZCQ73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0198 Quality Trim Threshold: 12.5