EST details — SGN-E311383

Search information 
Request: 311383Match: SGN-E311383
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99609Clone name: cLEZ-18-H2
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193567 [TUS-68-I21] Trace: SGN-T346488 EST: SGN-E545613 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193567 [TUS-68-I21] Trace: SGN-T346489 EST: SGN-E545614 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311383Length: 635 bp (897 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311383 [] (trimmed) GGAAATACTGCCTATGGTTCCCATGTCATGCAATTTGGTGATCTACAACTGAGTATGGAGTCTCTATTCAGGTTTATGGGTACAAATCCTGCAAA
TGATAACTACACTTATGTAGATGACAATTCCTTGTTGGCATCATCAAAGGCTGTCAACCAGCGTGATGCAGATCTTTTACATTTCTGGGACAAGG
TATGCCCCAACAAACGCCCCCTTTCCTGAGTTTGCGCTAAACATAAGAAGCAAAAATATCAAATACTACATAACAAATCAGCAGGAAATAAAGCT
GTTGAATCTTAAAGAACATATTAGTTAACAGTATGTCCTCTTTAAACAATATCTTTGCACCATCTTGCCACCATTGATGGTTTCATAACCATATT
AATGTGGTATAGCTGGTTTCCAAAAAGACACTAACATTACATTTATGAATGGTAGCAATGCTAAACAGGCGGGTAACTTGTGCTAAGCTGCAAGA
GTTATTTTTAGTAAGCCACATGTTGTAATTCGTGGGTCTTTATGTGTTTATGTATTAATTGGCTTGTGCCTCTGATGTGAAATGCCTTCTTATTG
ATTTTCTATTCTTCCTCAATGCTGGCAGTTCCGCAAGGCTCCTGAAGGCTCTGCTCGGAAAGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311383] SGN-U579856 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123598 [Download] [View] Facility Assigned ID: TRZCT37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5