EST details — SGN-E311499

Search information 
Request: 311499Match: SGN-E311499
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99721Clone name: cLEZ-18-P12
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311499Length: 560 bp (873 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E311499 [] (trimmed) GGCAGAGCGATAGCCCTCACAGCTTTGCGGTGACTCGCTCTGTCCCTGGTCCATCGTGTGCTGATGTGCTCCGGGCGATGCAGTTTGAGCCTGAA
CTCATGTTCGAGACTCTCAAGCACCGTGCAGAGGAATTCTTGGAACAAGGAGAAGGAGAAGGCGAAGGTGTTGCCTTTGGATCTTTGACCAGCAG
CTTAGCTCAGTCCTTCCACAACATGCCTTACCTTTCGTCTTGCTGCTTCACTGCAGAAGCCACTGCCAATGCCAATACCAATACCAATAATGGTG
GCTATTACTATTACAGTGAAGACAATGCTGCAGCAGAGGAAGATGAGATTTGGTCCTACTAAACTCTGCTTGAAGTGTCTCTTGTTAGCATCTCC
AGTTTGTTTTAGTTTGTGGTCGAGGTCGTCTGTTTTTTTATAATAATCCCACCCCTTAGTTTGGGTGCATGTTAATTACTTTTGTTTGCAATAGA
TGCAGTAGACTGTCATCTCCTATTGCAACTAAGCTTATGTTATGACCGCAATCAGTTTTATATTAATGCTGTCTTTTTTTGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311499] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123714 [Download] [View] Facility Assigned ID: TRZCT90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0017 Quality Trim Threshold: 12.5