EST details — SGN-E311581

Search information 
Request: 311581Match: SGN-E311581
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C117368Clone name: cTOA-6-M11
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311581Length: 411 bp (1176 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E311581 [] (trimmed) GGAAGAGATTGTTCTTTACAAAGAAACAATGCGTAAGAAACAGAGCAACAATATGGAGAGTTTTCAAAAAGCTTGTATGATTGAGAAATGGATGG
AACATAAAGCAAGTGAAAAAGTTGTTGTTCGAAGAAAATCTATAGCTGATTTCGAAAGGAATCTGATGAACTCGAGCTCGAGTTCTTCAGATTCG
AGCTGTGGGGGTGTGTTTTCTTCTTCAGAAACTGAATCCAGTTACAATAATGTAGTTATAAATTCTGCTGGGTCATCTTCTTCTTGTTATGGTCT
AAACAGGCCTAAACCAATCAGAACCTCAATTTCCGGTTCAAACCCTGAAAAACACAGCAAAAATCAAGCTAAACAGCTCAACAACTATGGCGATT
TCCGCCATAATCATCCTCCTATGGAAAGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311581] SGN-U573546 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124788 [Download] [View] Facility Assigned ID: TFAAU78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5