EST details — SGN-E311600

Search information 
Request: 311600Match: SGN-E311600
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100644Clone name: cLEZ-9-E1
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193366 [TUS-68-A12] Trace: SGN-T346143 EST: SGN-E545268 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193366 [TUS-68-A12] Trace: SGN-T350054 EST: SGN-E549179 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311600Length: 566 bp (825 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311600 [] (trimmed) GTGCTCATGGAATCGGACCTGATTCGACCTCGTATTGCTATACATGCTTTCTTCACTGCATGCTGCCGGGGATATGTAAATGTGGTGGACACTCT
CTTTAAGCTTGGAGTGACTGTGAATGCTACAAATCGTGTGTTGCTCCAGTCAAGTAAACCTTCTCTGCATACAAATGTGGACTGCACAGCACTTG
TGGCTGCGATTGTTTGTAGGCAAGTCTCTGTAGTTCGTCTGTTGCTTGAGGCTGGTGCAAAAACTGATGGACCAGTCCAACTTGGAGCCTGGTCC
TGGGATGCAGCTTCAGGTGAAGAATTTCGAGTAGGTGCTGGGTTAGCAGATTCCTATGCCATTACTTGGTGTGCTGTGGAGTATTTTGAAGCAAG
TGGCGCTATTTTGCAAATGCTCCTCCAGCGGCTTGATTCCTGCACAACTCTCAGTGGAAGAACTCTTCTCCACCATGCTATTCTTTGTGGTAATG
CAGGAGCAGTTTCGGTGCTTTTGAAATGCGGTGCTTATGTGGAATCTCCAGTTATAACCACCCGGAACATTGAGTTTCGTCCTATACACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311600] SGN-U568169 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122205 [Download] [View] Facility Assigned ID: TRZBG25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5