EST details — SGN-E311638

Search information 
Request: 311638Match: SGN-E311638
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100715Clone name: cLEZ-9-I18
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193377 [TUS-68-A23] Trace: SGN-T346162 EST: SGN-E545287 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C193377 [TUS-68-A23] Trace: SGN-T350057 EST: SGN-E549182 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311638Length: 491 bp (1218 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311638 [] (trimmed) GCCAAGCTGTATCGGCAAATGGATTGAGGCTAACCGCTGTCAGATTGATGTCGTCGCACGATGACCATATCACCAAAGATGAAGTCATCAAGAGA
GTCCTTGATGTCGTCAAGTGCTTCCCTAAAGTCGACCCTTCCAAGGTGACCCCTGAAGTCCACTTTGAGAAGGATTTGGGCTTAGACAGCTTAGA
TACGGTAGAGATTGTAATGGCTCTGGAGGAAGAGTTCAAACTGGAGATTCCAGACAAGGAAGCTGTGAGGATAGAGTCATGCGAACAGGCTATTG
AGTATGTTTATAATCATCCAATGTCGAGTTAAACTCGGTACACCACATTGTTAGTTTGAATTTGTTCATCAAAATCGAAGGTACACTTGCCCCTT
GTCATTTGACTAGTTTCAAGGTTGTAGAATTCTGTGATCCTCTTTGGGTTTTGGAGAGGCAATAATCAGACTCTTATAAAGACAAGTCGAGCAAG
CTTTTCAGTGAAAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311638] SGN-U570432 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122243 [Download] [View] Facility Assigned ID: TRZBH57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.995 Expected Error Rate: 0.0164 Quality Trim Threshold: 12.5