Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E311768

Search information 
Request: 311768Match: SGN-E311768
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100752Clone name: cLEZ-9-K2
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: Alias clone SGN-C185232 is on microarray TOM1: SGN-S1-1-3.2.12.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185232 [TUS-46-N14] Trace: SGN-T192037 EST: SGN-E390711 Direction: 5' Facility: INRA
Clone: SGN-C185232 [TUS-46-N14] Trace: SGN-T192281 EST: SGN-E390955 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311768Length: 505 bp (1593 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311768 [] (trimmed) GGTTGGGTATTGTAAAATCTGTTTGAATGGTAGTAACAGAACAAGATTTGGAATTTTCTTGGAAATTTGATTATTGGGTTGTCGATTGGAAGGTA
AAGTTGCAATCTTGGAAAAAAATTGGGAAAAAAAGATGACATCTTCAGCTGTAAATTTGGTGATGACAGTGATTGGGTTTACAGTGAGCATTATA
TTCATAGTATTTGTGTGTACAAGGTTAATTTGTGCAAGAATTCAGTATTTGACAAGGAGGAGGTCTTCTGCATATACTTCTAGATCTGATCTTAG
CATTTTGGAACGTGGTTTACATGGGCTGGAGCCTCTTGCTGTGTCGAAGTTCCCCACGAAGAAGTACAGTGATGCATTTTTTTCATTTGCAGAAA
ATACTCAATGCATGATTTGCCTTGCTGAGTATCGGGAGGAAGATACATTACGTATTTTGCCATTATGTGGACACTACTTCCACGCCACATGCATC
GACATATGGTTTCAGCAGCACTCTACATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311768] SGN-U564201 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122373 [Download] [View] Facility Assigned ID: TRZBH61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5