EST details — SGN-E311975

Search information 
Request: 311975Match: SGN-E311975
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C112458Clone name: cTOA-16-N16
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311975Length: 354 bp (523 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E311975 [] (trimmed) GCTTTCTTCATCTACATTTGCTGGAAAGGCAGTAAATCTTCTTCTGAAATCACCGGAAATGGAAGATTCACCATGAGGAAGACTGCCGCTGCCAA
GGCCAAGCCTGTCTCTTCTGGTAGTCCATGGTATGGGCCTGACCGTGTGAAGTATTTGGGCCCATTCTCTGGTGAATCCCCAAGCTACTTGACTG
GTGACTACGGATGGGACACTGCTGGACTTTCAGCTGATCCAGAAACTTTTGCTAATAACCGTGAGTTGGAGGTTATCCATTGTAGATGGGCCATG
CTTGGAGCATGCTCTTGGTTGTGTATTTCCCGAGCTATTAGCCTAAAGTTTGGGGAGGCTGTTTGGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311975] SGN-U581613 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T126084 [Download] [View] Facility Assigned ID: TFACL80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0136 Quality Trim Threshold: 14.5