Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E312309

Search information 
Request: 312309Match: SGN-E312309
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C117118Clone name: cTOA-5-C5
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: Alias clone SGN-C182609 is on microarray TOM1: SGN-S1-1-2.1.6.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182609 [TUS-40-A7] Trace: SGN-T191785 EST: SGN-E390459 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312309Length: 612 bp (951 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E312309 [] (trimmed) CTCCATTACACTTTTCTCTCATTCTTCTTCCTCTTCACCCTTCTTGAATCTACCCCAAACCCAGATATTGCGCCATTGCTAGCTTTCAAATCAGC
TTCAGATGAAACAAACTCACTTTACAACTGGAACTCATCAACTGACCCCTGTTCTTGGACTGGTGTATCTTGTCTTAACAATAGGGTGTCAAGAC
TTGTTCTTGAAGGTCTTAATCTAAAAGGGTCTTTTCAGAATCTGGTGTTTCTCAAAGAGTTGAGAGTATTGAGCTTGAAATATAATAATTTTTCT
GGTTCTGTTCCGAATCTTTCGAACCTTACTGCTTTGAAGCTGTTGTTTCTTTCACATAATGAGCTTTCTGGGGAGTTCTCTGAGTCGTTAACCTC
GCTTTTTAAGCTTTATAGACTTGATCTGTCGTATAATAAGTTTTCCGGGGAGATTCCGGCTAAGGTCAATCATTTGACACATTTGCTTACTCTTC
GTCTTGAAGGAAATGGGTTTTCCGGTGAGATTTCTGGGGTTAATCTACCTAATCTTCAAGAGTTTAACGTTTCCGGTAACAAACTCGTCGGAGAA
ATACCCCTTTCTCTATCTCGTTTCCCGGTATCTGCATTTTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312309] SGN-U572454 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124601 [Download] [View] Facility Assigned ID: TFAAQ15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5