EST details — SGN-E312453

Search information 
Request: 312453Match: SGN-E312453
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100156Clone name: cLEZ-20-K22
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312453Length: 568 bp (1024 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E312453 [] (trimmed) GGGCATTGCAGCGGTTACATGGCTCCAGAGTACGTTGTACGTGGCATACTGACTGAAAAAGCTGATGTCTATAGTTTTGGCGTTCTTGTTGTTGA
AGTCGTGTGTGGAAAGAAGAACAATTACGTTTTCAAGAACACTAACTCTCTTCTGCAACAGTTGTGGAACTTGTATGGGATGGGAAAATCTAATG
AAGCAGTTGACCCTTTATTAGAAGGTAACTTCAATAAAGAGGAGGCATCTAAACTGCTTCAAGTAGGTCTTGTTTGTGTACAAGCATCAGCAGAA
CTACGACCCTCTATGTCAAGTGTCGTGAAAATGCTCAGCGAGAACCATGAAATTCCTCAGCCAACACAGCCACCATTCCTCAATTCTGGTAGTTC
AGAATTTAGTCCATTTAATCTGCATGGGAAAAGATTTTTCGGCCAACCAAGCTCCTCGACACAATCTTCTGGGAATAAATTGACGGAGAGTTGGA
TAGAGCCTAGATAAACTAAAAGTTGATCATCTGGAATTGGTATTTGATTTTGTTCAAGTTTTTTTCTGTGATTAACTACTACTCACTACTCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312453] SGN-U582278 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123921 [Download] [View] Facility Assigned ID: TRZCZ71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0094 Quality Trim Threshold: 12.5