EST details — SGN-E312473

Search information 
Request: 312473Match: SGN-E312473
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100015Clone name: cLEZ-20-B9
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193618 [TUS-68-K24] Trace: SGN-T346576 EST: SGN-E545701 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312473Length: 488 bp (870 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E312473 [] (trimmed) GAAGACAAGCTAAGCCATATTCATCATTTCCTTATAAGCCACAAAAGATAATATGGGTATTTTTCTCCAACTATGGCTTCAAAAAGAATTGCTAT
AATTTGCATGGCTTTTGTCCCAATTATCATTGCCATGATTTCAGTACAAGTAGCCATGGCTCAATCTGATTGTACAAATACACTTATTACTATGG
CTTCATGCCTTAGCTTTGTCACCGGAAGTGCGAAAACGCCATCGGCTTCTTGCTGCTCCGCCCTCTCCGGGGTGTTGCAGTCTAAGCCACGGTGC
CTTTGCGTCATTGTCAACGGTGGCGGTTCATCGTTAGGAGTCCAAATTAATCAAACTCAAGCACTTGCATTGCCTAATGCATGCAATTTACAAAC
TCCACCCGTTAGTAAATGTTACGAGGGTGCACCTACAGAAAGAGCTCCAGATTCTTCGACTGGTATAGCTGTCTCAGGCTCAAAAGCATCAAGAA
GCAACATCATGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312473] SGN-U566148 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123941 [Download] [View] Facility Assigned ID: TRZDA05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0247 Quality Trim Threshold: 14.5