EST details — SGN-E312475

Search information 
Request: 312475Match: SGN-E312475
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100027Clone name: cLEZ-20-D1
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193622 [TUS-68-L4] Trace: SGN-T346582 EST: SGN-E545707 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193622 [TUS-68-L4] Trace: SGN-T346583 EST: SGN-E545708 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312475Length: 519 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E312475 [] (trimmed) GCGGCACGAGGCTCAAATTATGTTGATAGGGAGAAGCAAAAGCAAGCAGACAATGATATCAAGGACATGATCTCTTCTCTGACTAAACGTCTAGC
CGGCCTCCAACGCGTGCACAAGGCATCAGGAGGAGACTCAGGCCAGAATCTTCAAGGTGATGATGAAGATGATCATGGCACCAGAATCATCACTC
TAGCTGGAACCAATGTGGGAGCCAGCATGCGCGGTGAGATGGATGAGAAAGCTGGGATCGAAGGTGTTTCACCAGGGGAAAATGAGGCCTTAAAA
ACATATGTCAACAGCAATTTCCAGTCCATCAACAATTCCATCATGATGGGTGGTAGCTATTGTACTAATGACCCTGGTGTTCATTTGGACATAAC
TGATCGTGTCGATGAACAACTCCCAAAACCACAAGGATATAAACACAAGAAAGGCAAGAAAAGTGACCATCACTATGAACATTCAGAATAGACTT
ATACCATAACCAAGAAGCTGCTAAAAAATTTCAAACCAATACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312475] SGN-U584980 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123943 [Download] [View] Facility Assigned ID: TRZDA13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0119 Quality Trim Threshold: 12.5