EST details — SGN-E312531

Search information 
Request: 312531Match: SGN-E312531
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100060Clone name: cLEZ-20-F10
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193629 [TUS-68-L11] Trace: SGN-T346594 EST: SGN-E545719 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193629 [TUS-68-L11] Trace: SGN-T346595 EST: SGN-E545720 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312531Length: 582 bp (954 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E312531 [] (trimmed) GATTCGAACTAATATACACCGAAGAAGATTCTCCACCAGATCAGTTTGAGTATCCAGTGACACAACCAGGGCTAGGAGGAATATTAGAGTATCTC
AAGCAAGCTTATGGCGATATTCCAATATATATTCACGAAAATGGTCAAATGACAAGACGAAATGGTACGTTAAATGATACAAGAAGGGTGGAATA
TCTGCAAGCTTACATTGGGAATGTGCTTGAAGCTATGAGGAATGGATCAAACGTGAAAGGCTATTTCGTGTGGTCATTCTTAGACTGTTTTGAGT
TACTGGATGCATATGGTTCAGGATTTGGCTTATACTATGTGGATTTGGATGACAAAGAGTTAACAAGATATCCAAAGCTTTCTTCACATTGGTAC
ACTAATTTCTTGAAGGGGAAAGAACTCCAAACATAGTGAAATTCATCAGATTGAAGATAAAGTACTTCATTCTTCACAATAGGTATTTTGTGGTT
TCATTTGTATCTTCACAATAATGATGTATTATTTCCTAAGTTGGGGTGGACTTTTCACTTTCAATGCTGCATTCGTGTCGAATTCTATAAAATGC
ACTATTTTTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312531] SGN-U583154 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123999 [Download] [View] Facility Assigned ID: TRZDB29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0077 Quality Trim Threshold: 12.5