EST details — SGN-E312605

Search information 
Request: 312605Match: SGN-E312605
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100035Clone name: cLEZ-20-D19
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312605Length: 419 bp (870 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E312605 [] (trimmed) GGTGAGTTCTGCAAAAGTATGGTTTTCTTGCAAACACATCGCGCAGCCTCGGTTTTCTGTGAAGATGGGTCACTCTAACATCTGGAACGCTCACC
CAAAGAACTACGGCCCTGGCTCTCGCACATGCCGTGTGTGTGGTAATCCTCATGCAATTATTAGAAAGTATGGACTCATGTGTTGCAGACAGTGC
TTCCGCAGCAATGCCAAGGAAATTGGCTTCATCAAGTACCGTTAAAAATCTTGAATACGAGTTTCTACGAGGACCTCTACATTTGGTGCTGGTAG
AAGACATATGGCATTAGAGCTTTTTGATTTGCATCTCCCTTCAGTTAAATGATGTAATGGGATAATTTTGATTTATGTTTTAACTTTTGGAAGTA
ACTGCTATGTGAACCTAAGAAAGACTAGCTTTTAAGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312605] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124073 [Download] [View] Facility Assigned ID: TRZDA22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0041 Quality Trim Threshold: 12.5