EST details — SGN-E312617

Search information 
Request: 312617Match: SGN-E312617
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100134Clone name: cLEZ-20-J15
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193639 [TUS-68-L21] Trace: SGN-T346612 EST: SGN-E545737 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C193639 [TUS-68-L21] Trace: SGN-T350131 EST: SGN-E549256 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312617Length: 531 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E312617 [] (trimmed) AATGGCTGCTACCGACAATGTCAACCATAACTCCCCTTCCAAGCCTTCTCTTTACCTTCAGAACATGGATGAGGTGCAGAAAGTGTTTCAACGGT
TCGACACCAACGGCGACGGCATGATATCCGGCGAAGAGCTCTCCGGCGTCATCAGTGCTCTTGGATCTGGTACCATCTCCTGAAGAAGTCTCTCG
TATGATGAATGAAATTGATTCTGACAGAGACGGTTTCATTAGCCTTCAGGAATTTGCTGAGTTCTGTAAAGGCGACATTAACAGCATCGGTGACG
GTGGCGTTAGGGAGCTTCGTGAAGCGTTTGATCTGTACGATCAGGACAGTAACGGATTGATCTCCGCCGCTGAGCTTCATCAGATCCTGACTCGT
TTAGGCGAAAACTGCTCCGTTCAGGACTGTACCAAAATGATCAACTCCGTTGATTCCGACGGCGACGGTTACGTTAGCTTTGAAGAGTTTAAGAA
GATGATGACTACCAGCAAGTAGGCTCTTTCTAGTCTTTGTTTTACTATCCCTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312617] SGN-U579475 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124085 [Download] [View] Facility Assigned ID: TRZDA56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0278 Quality Trim Threshold: 14.5