EST details — SGN-E312943

Search information 
Request: 312943Match: SGN-E312943
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C112184Clone name: cTOA-14-G17
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312943Length: 421 bp (1048 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E312943 [] (trimmed) GAGACTTCTCTATGTCTTTGGTGGTTTTGGTGATGATAACAGGCATACTAATAAAGTTCACGTCTTTGACAATGTTAATAGAATTTGGAGTGAGC
CAGTGACAAAGGGAACTTTGCCTTCACCAAGGGACAGCCACAGTTGTACAGCAGTTGGAGATAATTTGTTTGTGTTCGGGGGCACAAATGGGACA
AATTCTCTTAACGATTTATACATTTTGGACACCTCTTCGAATACATGGATAGCACCCAGTCTAAGAGGTGATCCCCCTAATCCAAGGGAAGGCCA
CAGTGCAGCACTCATTGGTAAACGGCTTTTCATATTTGGCGGATGTGGCAACATTGATGGCACTGAAATATTCTATGATGACGTATACGTACTGA
ATACAGAGACACTTATGTGGAAACGCATTATGCCATCAGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312943] SGN-U580268 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T125786 [Download] [View] Facility Assigned ID: TFACA45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5