| SGN ID: SGN-C112518 | Clone name: cTOA-17-D17 |  | Order Clone |
|
| Library Name: cTOA | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants
Microarray: Alias clone
SGN-C182817 is on microarray TOM1: SGN-S1-1-2.1.5.8
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E313750 | Length: 326 bp (775 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E313750 [] (trimmed)
GGGGGTTTTTTTTATGAAAACTGGGTCCTAAATTCTCTCTTATGGATTAAAAATAAGAGGTTAATTAACATAACTCAGAATAACAAACTAGTAAA
AAAAAATTGTCACTACTGACTAGCTGCACCACAGGTATTATCTTCAGAAACAGCAGGAGAGTCAGAAACAGAATCAGTAGCAGTGTCATGAGAAG
GTGAAACTTCAACACCTCTCAACTCTTTAATCATTTTCACAACATAATTTATTTTAAGCCTTTGATCTGGTGATGTTGAAGTGCATGCCATAACT
ATCTGCAATAACCCTACCATTTCTTCCTCGATGGCCTTATA
[BLAST] [AA Translate]
| SGN-ID: SGN-T126364 [Download] [View] |
Facility Assigned ID: TFACO21TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.949 |
Expected Error Rate: 0.0247 |
Quality Trim Threshold: 14.5 |
