Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E313750

Search information 
Request: 313750Match: SGN-E313750
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C112518Clone name: cTOA-17-D17
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: Alias clone SGN-C182817 is on microarray TOM1: SGN-S1-1-2.1.5.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182817 [TUS-40-I23] Trace: SGN-T191813 EST: SGN-E390487 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E313750Length: 326 bp (775 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E313750 [] (trimmed) GGGGGTTTTTTTTATGAAAACTGGGTCCTAAATTCTCTCTTATGGATTAAAAATAAGAGGTTAATTAACATAACTCAGAATAACAAACTAGTAAA
AAAAAATTGTCACTACTGACTAGCTGCACCACAGGTATTATCTTCAGAAACAGCAGGAGAGTCAGAAACAGAATCAGTAGCAGTGTCATGAGAAG
GTGAAACTTCAACACCTCTCAACTCTTTAATCATTTTCACAACATAATTTATTTTAAGCCTTTGATCTGGTGATGTTGAAGTGCATGCCATAACT
ATCTGCAATAACCCTACCATTTCTTCCTCGATGGCCTTATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E313750] SGN-U575550 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T126364 [Download] [View] Facility Assigned ID: TFACO21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0247 Quality Trim Threshold: 14.5