EST details — SGN-E315071

Search information 
Request: 315071Match: SGN-E315071
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C122658Clone name: cTOB-4-K10
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: Alias clone SGN-C182911 is on microarray TOM1: SGN-S1-1-4.1.5.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182911 [TUS-40-M21] Trace: SGN-T191610 EST: SGN-E390284 Direction: 5' Facility: INRA
Clone: SGN-C182911 [TUS-40-M21] Trace: SGN-T191824 EST: SGN-E390498 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E315071Length: 510 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E315071 [] (trimmed) AGTTTGTCTCCATTGTCTCTTCTTCACATTCTTATTATTATTATTACTATTGTGTGTATGTGTATGATGATCAATTCCTCATTGACATCACTATT
ATGCCGCAGCTTTTGACTCATCTATAACAGACAATAAAGAGATTCCTTCAATCATTTTTCACCCCACTCCTTCACTTCCCCTGTTTTTCTTCCTG
TTGCTCTGCTTTTTTTTCTTCTTCTATAAAAATACTCAGATATGGATAGGTATAGTTATCAACGGGAGAGGGAAATTTCTCATTCTTCAAACCCA
TCTTTCTCTTCTACACTTCTTGACGCAATTTACCGTTCAATTGATCAAGGAGAAGAAGAAGAAGAGATTGTTCTTTACAAAGAAACAATGCGTGA
GAAACAGAGCAACAATATGGAGAGTTTTCAAAAAGCTTGTCTGATTGAGAAATGGATGGAACATAAAGCAAGTGAAAAAGTTGTTGTTCGAAGAA
AATCTATAGCTGATTTCGAAAGGAATCTGATGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E315071] SGN-U573546 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T130559 [Download] [View] Facility Assigned ID: TFBAN65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0210 Quality Trim Threshold: 14.5