EST details — SGN-E315161

Search information 
Request: 315161Match: SGN-E315161
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C114620Clone name: cTOA-24-F13
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E315161Length: 524 bp (917 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E315161 [] (trimmed) GGGCAGCCTTCCCGGAGACTTCGGTTTCGATCCTCTTGGTCTAGCATCTGATCCAGAGAGCTTGAGATGGAACCAACAGGCAGAACTTGTACACT
GCAGATGGGCAATGTTGGGAGCTGCAGGAATTTTCATTCCAGAATTACTCACCTGCAAAGATAAAGGAGTTGAGGACAAAGGAGATTAAGAACGG
TAGACTTGCTATGTTAGCCGTTATGGGTGCATGGTTCCAACACATTTACACTGGAACAGGCCCTATTGATAACCTATTTGCTCACCTAGCTGATC
CTGGTCATGCCACTATTTTTGCTGCATTCAGTCCCAAGTGAGAAGCAGAAGCAGAACACCTTTTGTTGTAATGATGTGTAAAAGTAACATTTGAA
GTACATTTGTGCAAAGAAAAACTTTAATGTTTCTTTTGCCACTCAATGTAGTATACCTACATTTGGTTTGCCCTCCTGTAGAAAAAGACTCAGTG
TACAAATACCTTTGAGAATTCGTGTCAGATCAAAAAAATCTATTTATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E315161] SGN-U578112 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T128125 [Download] [View] Facility Assigned ID: TFADQ31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0040 Quality Trim Threshold: 12.5