Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E316287

Search information 
Request: 316287Match: SGN-E316287
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C114351Clone name: cTOA-23-H24
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E316287Length: 693 bp (929 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E316287 [] (trimmed) GTCCACCACTTTCCACCATTACTCTTCAAGCAAACAAATTTAACCCAGGTACATTTCGCAAAAATAGTTGTACATTCCAGGAATAACAACTAACA
ACTACCTGTCTTGACTCCAATTTCATAGCCTTTATGGATCTTCTACGTTACTCCGCCTCCCGCTATCCTGCAGCTCATCTTCAACTTCCCTTCCG
TACGCCACTTCGCCGGCGGTTCGTCGCCGTTAGGTCAAGTTTGAGCCTTCCGTTCGCGGAGCAGAAAGCTAAGTATTATAGCGAGCTCGAAGCTG
CTGTTGATGTTGTCGAGCGAGCTTGTCGTCTCTGCGTTGACGTGAAGAAGTCACTGTTCTCAAGTGATGGTAGGATTCTTGAGAAAAATGACCAG
ACCCCAGTCACCATTGCAGATTTTGGAGTGCAGGCTTTAGTTAGCTTGGAGATGAACAAACTTTTTCCCTCCATACCTTTGGTGGCTGAAGAGGA
CTCTGCATTCTTGCGTTCAAATAATCTGGTTGGCTCAGTGGTTGATGTTGTAAAGGATAAAGCAACTTTAGGAGATGAAGTAACAGAAGATAATA
TTTTGAAAGCAATTGACAGAGGGGGAAAGGATGCTTATGTATTTGCGCCTGAGCCAGCCACTTACTGGATTCTGGATCCTATTGATGGTACACGA
GGGTTTGTTAGAGGTAGTGAGGCTCTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E316287] SGN-U572028 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T128026 [Download] [View] Facility Assigned ID: TFADN48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5