EST details — SGN-E317705

Search information 
Request: 317705Match: SGN-E317705
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C122926Clone name: cTOB-8-D17
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E317705Length: 385 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E317705 [] (trimmed) GATCCAATACACCACATTCGTGATATATTTGTTCAAAATTAACCTTTATATATTTGTATAAAATTCAATTTCTTTCCCAAAATACCCTTTTGCTA
ATTGACTTTTCGAATTTAGAAGCAAATAAAAAATGTGTCTTTTAAGCTTTAGCGCTCTCCTTCTCTCTCTCACACACACACAGAGTCCCTTTTGA
CATCCTGTAAATTTCCTCAAAACCCTAATTTTCTCCCTTTTCCAACATCAATAATCAATTCATAATCCTTTTGTTAGATCTCTTGGTCCAATTTC
CAGCTAATTTTTCCATTTTTTGTTAGCTGTAATCCCAAGAAGATGAAAAGTCGATCCAATTCTTTGAATTCCGTGAAAAATCTGCATAATTCCCC
TCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E317705] SGN-U574491 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T130908 [Download] [View] Facility Assigned ID: TFBBE21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.901 Expected Error Rate: 0.0154 Quality Trim Threshold: 14.5