EST details — SGN-E318738

Search information 
Request: 318738Match: SGN-E318738
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C123151Clone name: cTOB-9-H18
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOB-9-H18.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E318738Length: 506 bp (768 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E318738 [] (trimmed) CTTTCTCTCTCTAAAAATAGTACGAATACACTCGCATCGTTAACATCGAAAAGCTTTTTGCTGCTGCTTCTTCTTCTTCTTCTTGCTCCGCCACC
TCAAATCTGAAAACCCATTTCAGTTAACAATGGAAGCAATCCAATCTGTATCATTTCGTCCGTCTCCACTCGAACCTCTACGAAAAAACATCCCC
CAGCTCACCAATGTGAGGTCATTGGGTGCTAGAAGAGCGCCTTTAACAGTAACAGCTTCTGCATCTACTGGTTCTGCTCCAAAAAGAGAGAAAGA
CCCAAAGAAAAGGGTCGGTATAACTGGGACGGGTCTTGGTTCTGAGTTTGGGAATGATGCCGATACTTACTATGACAGACTCTGGGCTGGTGAAA
GTGGGATTGCGCTTATTGATCGCCGTGATGCTCTTAAACTGACTACGAGATGTGGGGGACAAATTCGCGGGTATACATCTGAAGGGTGTATTGAT
GGGAAGAATGATAGGAGGCTGGATGATTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E318738] SGN-U591305 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T131108 [Download] [View] Facility Assigned ID: TFBBJ45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0164 Quality Trim Threshold: 20.5