EST details — SGN-E319247

Search information 
Request: 319247Match: SGN-E319247
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C119310Clone name: cTOB-16-K11
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: Alias clone SGN-C182764 is on microarray TOM1: SGN-S1-1-7.3.5.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182764 [TUS-40-G18] Trace: SGN-T187857 EST: SGN-E375963 Direction: 3' Facility: INRA
Clone: SGN-C182764 [TUS-40-G18] Trace: SGN-T187858 EST: SGN-E375964 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E319247Length: 437 bp (832 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E319247 [] (trimmed) GGTGACTAGTGAGTGAGTGCCTCGTAGATTATCTCTATTGTCATCACTGTTAACCTTTTCTTGAGAATAACAACAACACTCACCATAACATAAAC
AAAAAGAGAGAGAGGAAAAAGAAAACAAACTGAGCTGTGTAAAAGTTGTGAGTTGAGTCTCTCTGCATAAGCTTATCCAACAATATCAATGGGCG
AGGAAGAGAAGAAGCCTGCAGAAGAAGTGAAGAAAACAGAGGAAGAGAAGAAAGAGGATGCACCAAAAGTTGATGAAAAAACAGAGGAGAAGAAA
ACAGAGGAAGCACCAGCTCCTCCACAAGAAATTGTTTTGAGAGTTTACATGCATTGTGAAGGATGTGCTCGTAAAGTTCGTAAATCACTTAAAGG
ATTTCAAGGAGTTGAGGATGTTATAACTGATTGTAAGAGTCATAAAGTGGTGGTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E319247] SGN-U567923 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T132722 [Download] [View] Facility Assigned ID: TFBCI66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0094 Quality Trim Threshold: 14.5