Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E320504

Search information 
Request: 320504Match: SGN-E320504
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C119988Clone name: cTOB-22-G1
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E320504Length: 562 bp (964 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E320504 [] (trimmed) GCTTTGGCATCTTAGCTAACACTGAACATTATATTTACATGGTAAAGCTTCTTGGAATGGAAGGACAATTAAGAGAAGCTTATGAACTTGTTCAG
TCACTGCAAGAACCAATTGACTCCGGCATTTGGGGAGCACTATTATCATGCTGTGATGCTCATCGAAATTATGAGTTGGCAGATATTGTAGCTTG
TCGTCTTTTTGGGAATAAGCTAGAGAATAGTAGTTACAGAATTATGCTTTCAAATATGTATGCTAGTGATGGGAGGTGGGATTTGGTAAATAAGT
TGAGAGTAGATTCTGAGATAACAAAGTTGAAACTTCCTGGAAAAAGCTGGATTACTAGTAAAAAAACATTCCTTTGAAAGGAACTCTTGAGGTGT
CTTCTGTGACATCTTTCACGAGTTAACAGTTGCTGAATCTAGGATCAGAAGCTGTGAGAGGAGGTGGGATCGATCTAATTGTCTTGTCACAAAGG
GAATGTTATCATGTAATTCCATAACAAATGGAAAAGAAGATGAGTTTGACTCATTCTGCACTCAACTTAAATGATTCTAANCAGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E320504] SGN-U597899 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T133373 [Download] [View] Facility Assigned ID: TFBDG37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5