Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E323260

Search information 
Request: 323260Match: SGN-E323260
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C121834Clone name: cTOB-28-H17
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E323260Length: 517 bp (886 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E323260 [] (trimmed) GAGGCAACCTTATCTGGCCCTTGTTGTGAGACAATGTTAGGTTGGACATGAGAATCGCTTGGGAAGAACCCTTTGGTCCAGTTTTGCCCGTTATT
CGGATAAACTCAGTCGAAGAAGGAATTCACCACTGCAATGCTAGCAATTTCGGTCTGCAGGGTTGTGTGTTCACCAAAGACATCAACAAAGCAAT
ACTGATCAGTGATGCAATGGAAACCGGAACCGATCAGATTAACTCAGCTCCTGCTCGTGGACCGGATCATTTTCCGTTCCAGGGTATTAAGGACA
GCGGAATTGGATCACTAGGGATCACTAACAGTATTAACATGATGACTAAAGTGAAGACCACTGTGATCAATTTGCCAACCCCTTCTTATACTATG
GGGTAAATTAATCACTGTTTTTTGCTTTAGAAATTTGACAGAAATAATTAAGAATCCATGTTGTGGATGTTAATAAGCTCACACCAATTATTGTT
CATTTCTTGACCTTATGAAGATTAATATTGGTGGATTAGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E323260] SGN-U577789 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T135524 [Download] [View] Facility Assigned ID: TFBEG45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0177 Quality Trim Threshold: 12.5