EST details — SGN-E324100

Search information 
Request: 324100Match: SGN-E324100
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C127852Clone name: cTOC-3-F11
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E324100Length: 391 bp (891 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E324100 [] (trimmed) GGTTAGTTTCACGTTCTCTTCGCAATTTCCATTACAGCCGCTAGGTTTCCGTCCACTTCTTCTTCTCCATTAATATCTGTATGGTGTTCTTCTTT
TTTGAATTCTAGATTTTTTCTTTGAATTCTTGTTAATCTTTAATTTTCTTTGTTTAAATCAAGAAATTAGCTTCTTCTGAAGTCAGGGTGGGGAT
TTTTGGATCGTGTCAAAGTGTGTTAGAGGGTGATTATCTTTTGATTCACTTGTTTTTTTGCTTCTTTTGAGGGGGTAGCCGGGGCCTCGGCCTCG
GCGGGTTTTAATAGCCCCCAACTATTACAACATTGGGAAGAAGAACATCAATCTGTACAAACCCTTAAGTTAGTTTTTCTTTTTAATTCTTTGAT
TCTTTCTTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E324100] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T136673 [Download] [View] Facility Assigned ID: TFCAK30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5