SGN ID: SGN-C127941 | Clone name: cTOC-3-L17 |  | Order Clone |
|
Library Name: cTOC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E324115 | Length: 418 bp (927 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E324115 [] (trimmed)
GAAAATATCGAAATTGGCGCCGCTTTTCTCTGGTTTCTCTTTCTCTCTCTACAATCCCCTTTCTTCTCTCTTCTGAAAATTGTCAACCCAGATTT
GAAATTCCCAAATTCCATATACAGGGTTCACTTTTGATTTCTCTTTCGCCATGTCTATTCGTAGAAGAACCTTGCTTAAAGTTATCGTCCTTGGC
GATAGTGGGGTTGGTAAAACGTCATTAATGAATCAATATGTACACAAGAAGTTCAGTCAGCAATATAAAGCTACAATTGGAGCTGATTTCGTGAC
AAAGGAGCTTCAAATTGATGACAGGCTTGTTACACTCCAAATATGGGATACGGCCGGTCAAGAGAGATTCCAGAGTCTTGGAGTTGCATTTTATA
GAGGTGCAGATTGCTGTGTTTTGGTCTATGATGTTAAT
[BLAST] [AA Translate]
SGN-ID: SGN-T136688 [Download] [View] |
Facility Assigned ID: TFCAK69TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 |
Expected Error Rate: 0.0032 |
Quality Trim Threshold: 14.5 |