EST details — SGN-E325130

Search information 
Request: 325130Match: SGN-E325130
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C123748Clone name: cTOC-13-D9
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E325130Length: 285 bp (662 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E325130 [] (trimmed) ATTGCTAGCAACGGTGGAAGAGTCAGTTGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCTGTCGTACCTTCCTGATTTGTC
CGACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACCGTG
AGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTCGGGTGCACTGATGCAACCCAAGTCTTGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E325130] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T138270 [Download] [View] Facility Assigned ID: TFCBY17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0005 Quality Trim Threshold: 20.5