EST details — SGN-E325145

Search information 
Request: 325145Match: SGN-E325145
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C123814Clone name: cTOC-13-J3
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: Alias clone SGN-C182683 is on microarray TOM1: SGN-S1-1-8.4.5.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182683 [TUS-40-D9] Trace: SGN-T191846 EST: SGN-E390520 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E325145Length: 563 bp (932 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E325145 [] (trimmed) GAACACAAACAACAGGCAAGTGACTTATTCAAAAAGAAGAAATGGTGTTATAAAGAAAGCTAAAGAAATTACTGTTCTTTGTGAAGCTAAGGTTT
CACTTATAATCTTTGCTAGTTCTGGAAAGATGCATGAATATTGTAGCCCTTCTACTACGATAAGTGATATGTTGGATGGTTATCAAAAAGCTTCT
GGGAGGAGACTATGGGATGCTAAGCATGAGAATTTGAGTAATGAAATTGATAGAATCAAGAAAGAGAATGACAGTATGCAGGTTAAGCTCAAGCA
CCTCAAAGGAGAAGATATCAATCAACTTACCCATAAAGAGCTTATAATTATGGAAGAAGCCTTACAAAATGGACTTTCTAGTATCAGTGCCAAGC
AGTCTGAAATCTTGAGGATGGTCAGGAAAAATGATCAAATTCTGGAGGAGGAAAATAAGCAACTTCAATATGCTTTGCACCAAAAGGAGATGGGA
GCCATTGGTGGAAGTGGAAATATGAGAGGAATTCATGAAGAAGTGTATCATCAAAGAGAAAGGGATTATGAGTACCAAATGCCATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E325145] SGN-U573183 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T138285 [Download] [View] Facility Assigned ID: TFCBY50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0104 Quality Trim Threshold: 14.5