EST details — SGN-E325400

Search information 
Request: 325400Match: SGN-E325400
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C125491Clone name: cTOC-1-C12
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: Alias clone SGN-C182796 is on microarray TOM1: SGN-S1-1-7.1.6.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182796 [TUS-40-I2] Trace: SGN-T187942 EST: SGN-E376048 Direction: 3' Facility: INRA
Clone: SGN-C182796 [TUS-40-I2] Trace: SGN-T187943 EST: SGN-E376049 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E325400Length: 489 bp (778 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E325400 [] (trimmed) AATCATGTTTTTCCACATTGTATTGGAGAGAAACATGCAGCTTCATCCTCGTCACTTTGGTCGTGATCTTCGTGAAAAACTTGTGTCAAAACTGA
TGAAAGATGTAGAAGGAACTTGCAGTGGTCGACATGGTTTTATAGTGGCGATTACTGGGATTGAAAGTGTTGGAAAAGGATTAATTCGTGATGGA
ACTGGTTTTGTTACTTTCCCAGTGAAGTATCAATGTGTTGTATTTCGACCCTTTAAAGGTGAGATTTTGGAAGCTGTTGTCACCATGGTTAACAA
GATGGGATTTTTTGCTGAAGCAGGGCCTGTGCAGATTTTTGTCTCAAATCACTTGATACCTGATGACATGGAGTTTCAATCGGGGGATGTGCCAA
ATTATACAACTTCAGATGGTTCGGTTAAAATTCAGAAGGAAAGTGAAGTTAGATTGAAGATTATCGGAACACGTGTTGATGCCACAGAAATTTTC
TGTATTGGTACGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E325400] SGN-U569280 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T136138 [Download] [View] Facility Assigned ID: TFCAB18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5