| SGN ID: SGN-C124132 | Clone name: cTOC-15-B12 |  | Order Clone |
|
| Library Name: cTOC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E325741 | Length: 343 bp (897 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E325741 [] (trimmed)
ATCCACAAAATTCGATACCAGAACCAACACCAGCACCAGCACCAGCATCGACTTTTATGCCAAATCAAATTGGTCCAATATTAGGAAAACCATAT
GTAGACATAAAAACACTATATGATCTTGATAAAGAATTGGGAAGAGGTCAATTTGGGATAACCTATCTCTGTAGTGATAAATCAAGTGGATTGAA
ATACGCGTGTAAATCGATTTCAAGGAGGAAATTGGTAACACAAAAGGATATTGAAGATGTTAGAAGGGAAGTTACAATACTTCAATATTTAAGTG
GACAACCAAATATTGTTGAATTTAAAGGTGCTTATGAGGATAAAAACAATCTACATTT
[BLAST] [AA Translate]
| SGN-ID: SGN-T138570 [Download] [View] |
Facility Assigned ID: TFCCH06TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.924 |
Expected Error Rate: 0.0087 |
Quality Trim Threshold: 14.5 |
