EST details — SGN-E326264

Search information 
Request: 326264Match: SGN-E326264
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C123952Clone name: cTOC-14-E13
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E326264Length: 564 bp (963 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E326264 [] (trimmed) GCTTTGGGAATTGGATTCAGACCAGCACTATAGTGTTGGGGGGCACGCATCAAGTTTAGCAATGGAGAGTTCTAGGTCATTTATTAAAAGGTCGC
TGTCAGAAGGAAATTTGATCTGTGGAAGCAACTCTCCTGTCAAAGAAACTGACACAGAGCAGACCGATGACTCTGACCAACCTTTGCCTGAGAGT
GCAAAAGGTGGTAGTAAGGGTCTTTCCGAGTCCACCCCAGAAATCTCTACTTGTGAAACTGATATTTCATTTGCCAGGTAGCTTGGTTTAAATTT
TCTTTGCCACATAGATTTATTTTGATTAAGTGGATACTAAGTGCTAATCACTGTGAGAATTTGTATCACTTTGTGGTTCCTTCATACTCCATCGA
CAAATCCACTGCTGTGACTTTTGGTATACATATTTTTCAATGAAGAATATGTAACAATTTTGTTTTCAAGAAATAAGCTAGTCACAGGTTAGTTG
CTATTATATTCAGATCCCAAAGACATGTATTAATCAATTCTTCTCTCTTAAGGGGACTCGTATAGTCTATTATAACATTTAATGTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E326264] SGN-U576864 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T138609 [Download] [View] Facility Assigned ID: TFCCA31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5