SGN ID: SGN-C125157 | Clone name: cTOC-19-A6 |  | Order Clone |
|
Library Name: cTOC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E327395 | Length: 304 bp (1226 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E327395 [] (trimmed)
GCAATTTTGAAAGAACACAAAGCCCCTATTGCTGAATGCCTTGTTAAAGAAATTGCAAAACCAGCTAAAGATGCTGTCACCGAGGTTGTGAGATC
TGGTGATTTGGTTTCTTACACTGCTGAAGAAGGAGTTAGAATTCTAGGGGAGGGTAAGTTCTTGGTATCTGATAGTTTCCCTGGAAATGAAAGGA
CCAAATACTGTCTAACATCCAAGATACCGTTGGGTGTGATTCTGGCGATTCCTCCTTTCCACTATCCGGTCAATCTTGACGTCTCCAAGATTGCT
CCTGCACTGATTGCTGGAA
[BLAST] [AA Translate]
SGN-ID: SGN-T139792 [Download] [View] |
Facility Assigned ID: TFCCV03TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 |
Expected Error Rate: 0.0040 |
Quality Trim Threshold: 14.5 |