EST details — SGN-E329616

Search information 
Request: 329616Match: SGN-E329616
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C132822Clone name: cTOD-3-O9
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
See unigene SGN-U564802 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E329616Length: 511 bp (1098 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E329616 [] (trimmed) GGAACAATCCCTGTTTTTTCCTTTTCTCCCAAACCCTAACTCTCTCCTTCATCAAGAATATCTTCAATCAAATCTCTATCTTTGATTTTCTATCT
TTTTCATTTTTATTTTTTGTTACAGATTTCATTACATTTTCTTCAATCAGATTTCTGATTGATGAATCTTTCAAATCTGGTTGAGATTTGGATGT
TTGTTTCATTTGTTGGATGATTTAAACGATGATTGCAGATCCGAATTTGGTTTACTACTCTTGTGTTGCCAAAGGAACAACTATCCTTGCTGAGA
TCAATTCAAAAGATGCCGATCTTGGATCCCTAGCTTTGAAATGCCTTGAAAAGACTCCTCCTTTGCATACCTTCTTCTCTCATACTATCCGAAAC
AGGACATACACGTTCCTGATTGAAAACCCATATGTGTTTTTCGCCATATTCGATGAAAAAATTGACAAATCGGATGGTCTTGCGTTTCTCAAAGG
GGTTGAAGAGGCGTTTCGTGGAGTAATTGAGAGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E329616] SGN-U564802 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T142071 [Download] [View] Facility Assigned ID: TFDAI89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5