EST details — SGN-E330295

Search information 
Request: 330295Match: SGN-E330295
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C133093Clone name: cTOD-4-L5
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: Alias clone SGN-C182933 is on microarray TOM1: SGN-S1-1-6.2.5.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182933 [TUS-40-N19] Trace: SGN-T195460 EST: SGN-E394134 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E330295Length: 641 bp (908 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E330295 [] (trimmed) GCATAGATCTTCCTAAGTTTGAGGTCTAACCAACCGAGATAAATGGGGAAAGAACTAGATCACTCCAAGAGCCTTGACAAGGAAGAGGCTGTCAT
CATGCAGAATATCGATGAGGATGAGATTTTTCCACCTGAAAAAAACAGGAATAGTTTGTGCATTCGGAAAATAGAAGGCAATAAAAAGACTAAGA
CGCGCTTAATGAAGATGCGAAGCCTAGACTCTGCTGAGGAATCACCAGTACATGGAAAATCTTTGTGTCTAGCAAGATCATTTAGTTCTCATTTT
CTTATTAACATAGATGAGATGATGAGTGATGTTGGTAATGAAAAAGGTGCACTTATAAAGAACAATATATTGAAATCGAAGGATCAGGAGGATGA
CGATTCATGCAGCTGGAATAGAATTCAGATTGAGCCTACCTTACGTATACGTCTCAAGTTTCAAGATGTGAAGTACTCCGTTGCACTGAAGGGAG
TGGAGAATTCTGATACAGAAAAGTGCATACTTCAAGGAGTGAGTGGTTCAGCCTGTCCAGGAGAAATTCTCGCGTTAATGGGACCTTCCGGTGGT
GGTAAAACAACCTTACTCAAGCTTCTAAGTGGAAAGGTGAAAAATGATAGTGGCACGATTACTTTCAATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E330295] SGN-U566297 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T142460 [Download] [View] Facility Assigned ID: TFDAO63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5