Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E330833

Search information 
Request: 330833Match: SGN-E330833
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C129069Clone name: cTOD-10-F9
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
See unigene SGN-U564473 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E330833Length: 400 bp (987 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E330833 [] (trimmed) GAGTGTTAGCTGTGAAATGAACTTTGGGTACTCACTTGCAGATCGAATCTAGCATTTTCAGGGATCATTCTCTTTTCCATTGCTGGTTTTGTGGT
GTCACATCCTGTTTACTGTATGTCCAAGGGAACCGTAGCACAGCGTAGTCCGCCTGATGTTCTTCAGTAGCCTTATTATGCTTGATCAACGCCAA
GATGGGCGACTTCTCTTCGAAAATTCAGGATTTGTTGTTTTTAAGCGTGCTGTTGCTTTGCATTTTCCCAAGACTTACACTAGCACTCAATCCTG
ATGGTCAAGCGCTTGTCAATTTTAGGATTGCAATATCTGGTTCCGATGGTGTTCTTGAGCAGTGGAGACCAGAAGATTCTGACCCATGTGGCTGG
AAAGGGGTACAATGTGACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E330833] SGN-U564473 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T144183 [Download] [View] Facility Assigned ID: TFDBM29THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5