Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E330913

Search information 
Request: 330913Match: SGN-E330913
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C129044Clone name: cTOD-10-E2
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E330913Length: 503 bp (1061 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E330913 [] (trimmed) GGGAGCCATCTAAATAAAGCACACCATCTTTTGAATCTTTGCAATTTAGAAAGAGAACTCCACTTTCACTTTTAGATGTTCCAATTTTTTTTTCT
TTTATAAATAGTGTAGCTATTAAAACCCTCTATTTCCAAGCAATCTCTTTAAAAAAAAAAATTAACAAGTTTTTTCTTGCTATTTTTCTTCTTAA
TTCCTTCATCTCTTCTAGCATCAAATTTTATAACCATCGGATCGATGTTCAAATTCTGTTGAACTTAAGATCCGATGGTATACTAAAGAGTACCC
TCCATATTTACCCCCTATATTTCAACAACTTTACGTATATACCAAAATATCAAGTATAGCTCGTAACCAATCTATCCGTTGAACTTCTAGGCCGA
TCAAATCAAATAAGGAAAAAAAACCCTAATATTTGAAAACTAACCCTACCACCTTTTTTACTCATATTTCATCGTACTGCTAGTCGTTGTAAATG
GCTGATAAGGTCCAACGAATGTCATCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E330913] SGN-U574843 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T144263 [Download] [View] Facility Assigned ID: TFDBL25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0284 Quality Trim Threshold: 14.5