Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E331176

Search information 
Request: 331176Match: SGN-E331176
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C133771Clone name: cTOD-6-P10
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E331176Length: 513 bp (966 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E331176 [] (trimmed) GGAAGCTATGGCGATCCTTCGATTAGCCCTAGTTTTCTCTATATTGACCTCATTTTCGTTACTCGCCGGATCTTCACCGTCCCCTTCAACGGAGT
TGCAGATCGTCACCGCCGAACGCAGAATTGACTTGACATCACACATTGTGAAGGTGTTCTTGACATTGAAGGTTGAAAATATTGGTGAATCTCCT
GCTTCAGAAGTCCTTCTTGCCTTCTCTCCCACAGAAGCTGATCGTCTGGCAGTGGTAAAAGCAGCCGCTTCTGCTGGAAAGAAGAAAAAGAAATC
TTATGTGCCTCTAGATGTGAAGCCAACTGACCTGCCTGATGGACCAAATGGAACTAAGTATTATTTAATACATTTGCTTAAGCCATTGGGTAAAG
GTGAAGCCATCTCGCTAGAAGTTCTTTATATATTGACACATTCTCTTGAGCCTTTCCCAGTAGAAATAAGCCAGTCGGAGTCTCAATTAGTTTAT
TACCGTGACAGTGCAAAAATCTTGTCACCTTATCCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E331176] SGN-U569472 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T143147 [Download] [View] Facility Assigned ID: TFDAX89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5