EST details — SGN-E332796

Search information 
Request: 332796Match: SGN-E332796
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C130214Clone name: cTOD-18-L1
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E332796Length: 567 bp (893 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E332796 [] (trimmed) TTTTTTGAGCGAACTTGAACGATTTGGATTGTTTCCTCTTACCAGTTAATAAACAATCTACTTTTTCTATTTCTCACTTGGTTGCAGCGGAATTA
CAGATTCTTCTACTTGTTCATATCTACATCAACTATATTATGCATATATGTCTTTGTCATATCCTTGGTCAATATCCTTCATCGTGGCGGCAACT
TATGGAGAGCTATTTCACAAGATATCTTGTCAGATGTTCTCATTATATACTGCTTCATTGCTGTTTGGTTTGTTGGTGGCCTTACTATTTTCCAT
TTTTACCTGATTAGCACTAACCAGGTGAAATCTCTGACTAAGATGTCTACTAACAAAATTAGTTATGGTTCTTCTGTAATTTCATCTGCAATATG
AGTTGTTTTATGATGAATTGGCATATTTAGGAAGTCCAACTTAAAATTGCATATTTTCTATGGTGAATCATGTCTTATGGTTTTCATTGGAGTAT
ATTGTATGTGTGCCTGGTTCATAGTTAAAATATACCTTGCAGTATTAAGTATTAACTATTAACTATTCTAAGTGGCAGGAATATCTAGCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E332796] SGN-U596251 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T145410 [Download] [View] Facility Assigned ID: TFDCS61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0027 Quality Trim Threshold: 14.5