Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E332831

Search information 
Request: 332831Match: SGN-E332831
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C130135Clone name: cTOD-18-H10
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E332831Length: 634 bp (871 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E332831 [] (trimmed) ACTAGACGATCCTTTAATTAGGTTCAAACAATTGGATACGAGATGGAAGTCAGCAATAACACAAGTACGAACAACGAAATCAGGATGAAAAGGAA
AAGGAAAAAAATCGTTGCAGGTGAAACAGCAGCCTAAATGGAATCCAAAGCCTGAAGAACATCAGCTTTCACATCTTCAAAATCTTCCACTCCAA
AGCTAAATCGGACCAAGTTATCCAAGATGCCATACTTTGCTCTATCAGACTGGCTAAGATCCCAATAAGACATTATTGCTGGTTGGTCCACAATG
CTCTCACAACCTCCAAACGATGGAGCAATATAAGGAATCCTCAGAGCATCCACAAATTTTGCAGTAGTTAGGAGGTCTCCATCAACCTCAAAACT
GACCACACCACCAAAGCCAGTCATTTGTTTCTTTGCAAGGTGATATTCCGGATGACTCGGCAAGCCTGGATAATAGACGTGTTTCACCTTGGGAT
GAGCATCTAAAATTTCGGCCATCCTCAATGCAGTAGAATTTTGTTGCTGTACACGAAGATGCAGCGTCTTCATGCCTCGGATGATAAGATATGCA
GCATTAGGATTGAGAGCACCACCCAGGATATGATGCAAGTTTCGGATTACTGAAACTAATTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E332831] SGN-U578164 Tomato 200607 Build 2 105 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T145445 [Download] [View] Facility Assigned ID: TFDCT41TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0