Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E333129

Search information 
Request: 333129Match: SGN-E333129
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C130631Clone name: cTOD-19-P11
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
See unigene SGN-U564473 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E333129Length: 441 bp (958 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E333129 [] (trimmed) GAGTGTTAGCTGTGAAATGAACTTTGGGTACTCACTTGCAGATCGAATCTAGCATTTTCAGGGATCATTCTCTTTTCCATTGCTGGTTTTGTGGT
GTCACATCCTGTTTACTGTATGTCCAAGGGAACCGTAGCACAGCGTAGTCCGCCTGATGTTCTTCAGTAGCCTTATTATGCTTGATCAACGCCAA
GATGGGCGACTTCTCTTCGAAAATTCAGGATTTGTTGTTTTTAAGCGTGCTGTTGCTTTGCATTTTCCCAAGACTTACACTAGCACTCAATCCTG
ATGGTCAAGCGCTTGTCAATTTTAGGATTGCAATATCTGGTTCCGATGGTGTTCTTGAGCAGTGGAGACCAGAAGATTCTGACCCATGTGGCTGG
AAAGGGGTACAATGTGACTCAAAATCAAAGAGAGTTACATCTTTTAGCCTCCCTAATCACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E333129] SGN-U564473 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T145743 [Download] [View] Facility Assigned ID: TFDCW90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5